From 5d7de70bb1148e14b76cec11ea8afb2c8645a9c6 Mon Sep 17 00:00:00 2001
From: felmer <felmer>
Date: Wed, 30 Apr 2014 13:38:30 +0000
Subject: [PATCH] SSDM-85: BlastDatabaseCreationMaintenanceTask introduced.

SVN: 31442
---
 .../BlastDatabaseCreationMaintenanceTask.java | 318 ++++++++++++++++++
 .../etlserver/plugins/FastaFileBuilder.java   | 216 ++++++++++++
 .../plugins/FastaFileBuilderTest.java         | 196 +++++++++++
 3 files changed, 730 insertions(+)
 create mode 100644 datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/BlastDatabaseCreationMaintenanceTask.java
 create mode 100644 datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilder.java
 create mode 100644 datastore_server/sourceTest/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilderTest.java

diff --git a/datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/BlastDatabaseCreationMaintenanceTask.java b/datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/BlastDatabaseCreationMaintenanceTask.java
new file mode 100644
index 00000000000..5a3329ebe48
--- /dev/null
+++ b/datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/BlastDatabaseCreationMaintenanceTask.java
@@ -0,0 +1,318 @@
+/*
+ * Copyright 2014 ETH Zuerich, SIS
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package ch.systemsx.cisd.etlserver.plugins;
+
+import java.io.BufferedInputStream;
+import java.io.BufferedReader;
+import java.io.File;
+import java.io.IOException;
+import java.io.InputStream;
+import java.io.InputStreamReader;
+import java.text.MessageFormat;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.Collections;
+import java.util.Comparator;
+import java.util.List;
+import java.util.Properties;
+
+import org.apache.commons.io.FileUtils;
+import org.apache.commons.io.FilenameUtils;
+import org.apache.commons.io.IOUtils;
+import org.apache.log4j.Logger;
+
+import ch.systemsx.cisd.common.exceptions.ConfigurationFailureException;
+import ch.systemsx.cisd.common.exceptions.EnvironmentFailureException;
+import ch.systemsx.cisd.common.fasta.SequenceType;
+import ch.systemsx.cisd.common.filesystem.FileUtilities;
+import ch.systemsx.cisd.common.logging.LogCategory;
+import ch.systemsx.cisd.common.logging.LogFactory;
+import ch.systemsx.cisd.common.maintenance.IMaintenanceTask;
+import ch.systemsx.cisd.common.process.ProcessExecutionHelper;
+import ch.systemsx.cisd.common.process.ProcessResult;
+import ch.systemsx.cisd.openbis.common.io.hierarchical_content.api.IHierarchicalContent;
+import ch.systemsx.cisd.openbis.common.io.hierarchical_content.api.IHierarchicalContentNode;
+import ch.systemsx.cisd.openbis.dss.generic.shared.IConfigProvider;
+import ch.systemsx.cisd.openbis.dss.generic.shared.IEncapsulatedOpenBISService;
+import ch.systemsx.cisd.openbis.dss.generic.shared.IHierarchicalContentProvider;
+import ch.systemsx.cisd.openbis.dss.generic.shared.ServiceProvider;
+import ch.systemsx.cisd.openbis.generic.shared.basic.dto.AbstractExternalData;
+import ch.systemsx.cisd.openbis.generic.shared.basic.dto.PhysicalDataSet;
+import ch.systemsx.cisd.openbis.generic.shared.basic.dto.TrackingDataSetCriteria;
+
+/**
+ * This maintenance task creates a BLAST database for all files 
+ *
+ * @author Franz-Josef Elmer
+ */
+public class BlastDatabaseCreationMaintenanceTask implements IMaintenanceTask
+{
+    static final String BLAST_TOOLS_DIRECTORY_PROPERTY = "blast-tools-directory";
+    static final String BLAST_DATABASES_FOLDER_PROPERTY = "blast-databases-folder";
+    static final String LAST_SEEN_DATA_SET_FILE_PROPERTY = "last-seen-data-set-file";
+    static final String FILE_TYPES_PROPERTY = "file-types";
+    
+    private static final String DEFAULT_LAST_SEEN_DATA_SET_FILE = "last-seen-data-set-for-BLAST-database-creation";
+    private static final String DEFAULT_FILE_TYPES = ".fasta .fa .fsa";
+    private static final String DEFAULT_BLAST_DATABASES_FOLDER = "blast-databases";
+
+    private static final Logger operationLog =
+            LogFactory.getLogger(LogCategory.OPERATION, BlastDatabaseCreationMaintenanceTask.class);
+    private static final Logger machineLog =
+            LogFactory.getLogger(LogCategory.MACHINE, BlastDatabaseCreationMaintenanceTask.class);
+    
+    private File lastSeenDataSetFile;
+
+    private List<String> fileTypes;
+    private File blastDatabasesFolder;
+    private File tmpFolder;
+    private String makeblastdb;
+    private String makembindex;
+
+    @Override
+    public void setUp(String pluginName, Properties properties)
+    {
+        fileTypes = Arrays.asList(properties.getProperty(FILE_TYPES_PROPERTY, DEFAULT_FILE_TYPES).split(" +"));
+        operationLog.info("File types: " + fileTypes);
+        lastSeenDataSetFile = getFile(properties, LAST_SEEN_DATA_SET_FILE_PROPERTY, DEFAULT_LAST_SEEN_DATA_SET_FILE);
+        blastDatabasesFolder = getFile(properties, BLAST_DATABASES_FOLDER_PROPERTY, DEFAULT_BLAST_DATABASES_FOLDER);
+        operationLog.info("BLAST databases folder: " + blastDatabasesFolder);
+        tmpFolder = new File(blastDatabasesFolder, "tmp");
+        FileUtilities.deleteRecursively(tmpFolder);
+        if (tmpFolder.mkdirs() == false)
+        {
+            throw new ConfigurationFailureException("Couldn't create folder '" + tmpFolder + "'.");
+        }
+        String blastToolDirectory = getBLASTToolDirectory(properties);
+        makeblastdb = blastToolDirectory + "makeblastdb";
+        if (process(makeblastdb, "-version") == false)
+        {
+            operationLog.error("BLAST isn't installed or property '" + BLAST_TOOLS_DIRECTORY_PROPERTY 
+                    + "' hasn't been correctly specified.");
+        }
+        makembindex = blastToolDirectory + "makembindex";
+        
+    }
+    
+    private File getFile(Properties properties, String pathProperty, String defaultPath)
+    {
+        String path = properties.getProperty(pathProperty);
+        return path == null ? new File(getConfigProvider().getStoreRoot(), defaultPath) : new File(path);
+    }
+
+    private String getBLASTToolDirectory(Properties properties)
+    {
+        String blastToolsDirectory = properties.getProperty(BLAST_TOOLS_DIRECTORY_PROPERTY, "");
+        if (blastToolsDirectory.endsWith("/") || blastToolsDirectory.isEmpty())
+        {
+            return blastToolsDirectory;
+        }
+        return blastToolsDirectory + "/";
+    }
+
+    @Override
+    public void execute()
+    {
+        IHierarchicalContentProvider contentProvider = getContentProvider();
+        IEncapsulatedOpenBISService service = getOpenBISService();
+        List<AbstractExternalData> dataSets = getDataSets(service);
+        if (dataSets.isEmpty() == false)
+        {
+            operationLog.info("Scan " + dataSets.size() + " data sets for creating BLAST databases.");
+        }
+        for (AbstractExternalData dataSet : dataSets)
+        {
+            if (dataSet.tryGetAsDataSet() != null && dataSet.isAvailable())
+            {
+                try
+                {
+                    createBlastDatabase(dataSet, contentProvider);
+                } catch (Exception ex)
+                {
+                    operationLog.error("Error caused by creating BLAST database for data set " + dataSet.getCode() 
+                            + ": " + ex.getMessage(), ex);
+                }
+            }
+            updateLastSeenEventId(dataSet.getId());
+        }
+    }
+
+    private void createBlastDatabase(AbstractExternalData dataSet, IHierarchicalContentProvider contentProvider)
+    {
+        String dataSetCode = dataSet.getCode();
+        FastaFileBuilder builder = new FastaFileBuilder(tmpFolder, dataSetCode);
+        IHierarchicalContent content = contentProvider.asContent(dataSet);
+        IHierarchicalContentNode rootNode = content.getRootNode();
+        handle(rootNode, builder);
+        builder.finish();
+        SequenceType[] values = SequenceType.values();
+        for (SequenceType sequenceType : values)
+        {
+            File fastaFile = builder.getTemporaryFastaFileOrNull(sequenceType);
+            if (fastaFile == null)
+            {
+                continue;
+            }
+            String fastaFilePath = fastaFile.getAbsolutePath();
+            String databaseName = FilenameUtils.removeExtension(fastaFile.getName());
+            String databaseFile = new File(blastDatabasesFolder, databaseName).getAbsolutePath();
+            String dbtype = sequenceType.toString().toLowerCase();
+            boolean success = process(makeblastdb, "-in", fastaFilePath, "-dbtype", dbtype, 
+                    "-title", databaseName, "-out", databaseFile);
+            if (success == false)
+            {
+                break;
+            }
+            File databaseSeqFile = new File(databaseFile + ".nsq");
+            if (databaseSeqFile.exists() && databaseSeqFile.length() > 1000000)
+            {
+                process(makembindex, "-iformat", "blastdb", "-input", databaseFile, "-old_style_index", "false");
+            }
+            File allDatabaseFile = new File(blastDatabasesFolder, "all-" + dbtype + ".nal");
+            if (allDatabaseFile.exists() == false)
+            {
+                FileUtilities.writeToFile(allDatabaseFile, "TITLE all-" + dbtype + "\nDBLIST");
+            }
+            FileUtilities.appendToFile(allDatabaseFile, " " + databaseName, false);
+        }
+        builder.cleanUp();
+    }
+    
+    private boolean process(String... command)
+    {
+        return process(Arrays.asList(command));
+    }
+    
+    private boolean process(List<String> command)
+    {
+        ProcessResult processResult = ProcessExecutionHelper.run(command, operationLog, machineLog);
+        if (processResult.isOK())
+        {
+            processResult.logAsInfo();
+        }
+        return processResult.isOK();
+    }
+    
+    private void handle(IHierarchicalContentNode node, FastaFileBuilder builder)
+    {
+        if (node.isDirectory())
+        {
+            for (IHierarchicalContentNode childNode : node.getChildNodes())
+            {
+                handle(childNode, builder);
+            }
+        } else
+        {
+            String nodeName = node.getName();
+            for (String fileType : fileTypes)
+            {
+                if (nodeName.endsWith(fileType))
+                {
+                    appendTo(builder, node);
+                    break;
+                }
+            }
+        }
+    }
+
+    private void appendTo(FastaFileBuilder builder, IHierarchicalContentNode node)
+    {
+        InputStream inputStream = node.getInputStream();
+        BufferedReader bufferedReader = null;
+        String relativePath = node.getRelativePath();
+        builder.setFilePath(relativePath);
+        try
+        {
+            bufferedReader = new BufferedReader(new InputStreamReader(inputStream));
+            String line;
+            while ((line = bufferedReader.readLine()) != null)
+            {
+                builder.handle(line);
+            }
+        } catch (IOException e)
+        {
+            throw new EnvironmentFailureException("Error while reading data from '" + relativePath 
+                    + "': " + e.getMessage(), e);
+        } finally 
+        {
+            IOUtils.closeQuietly(bufferedReader);
+        }
+    }
+
+    private List<AbstractExternalData> getDataSets(IEncapsulatedOpenBISService service)
+    {
+        Long lastSeenEventId = getLastSeenEventId();
+        if (lastSeenEventId == null)
+        {
+            lastSeenEventId = 0L;
+        }
+        TrackingDataSetCriteria criteria = new TrackingDataSetCriteria(lastSeenEventId);
+        List<AbstractExternalData> dataSets = service.listNewerDataSets(criteria);
+        Collections.sort(dataSets, new Comparator<AbstractExternalData>()
+            {
+                @Override
+                public int compare(AbstractExternalData d0, AbstractExternalData d1)
+                {
+                    long id0 = d0.getId();
+                    long id1 = d1.getId();
+                    return id0 > id1 ? 1 : (id0 < id1 ? -1 : 0);
+                }
+            });
+        return dataSets;
+    }
+
+    private Long getLastSeenEventId()
+    {
+        Long result = null;
+        if (lastSeenDataSetFile.exists())
+        {
+            try
+            {
+                result = Long.parseLong(FileUtilities.loadToString(lastSeenDataSetFile).trim());
+            } catch (Exception ex)
+            {
+                if (operationLog.isDebugEnabled())
+                {
+                    operationLog.debug("Cannot load last seen event id from file :"
+                            + lastSeenDataSetFile, ex);
+                }
+            }
+        }
+        return result;
+    }
+    
+    private void updateLastSeenEventId(Long eventId)
+    {
+        FileUtilities.writeToFile(lastSeenDataSetFile, String.valueOf(eventId) + "\n");
+    }
+    
+    IConfigProvider getConfigProvider()
+    {
+        return ServiceProvider.getConfigProvider();
+    }
+    
+    IEncapsulatedOpenBISService getOpenBISService()
+    {
+        return ServiceProvider.getOpenBISService();
+    }
+    
+    IHierarchicalContentProvider getContentProvider()
+    {
+        return ServiceProvider.getHierarchicalContentProvider();
+    }
+
+}
diff --git a/datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilder.java b/datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilder.java
new file mode 100644
index 00000000000..5127c4ee847
--- /dev/null
+++ b/datastore_server/source/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilder.java
@@ -0,0 +1,216 @@
+/*
+ * Copyright 2014 ETH Zuerich, SIS
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package ch.systemsx.cisd.etlserver.plugins;
+
+import java.io.BufferedWriter;
+import java.io.File;
+import java.io.FileWriter;
+import java.io.IOException;
+import java.io.PrintWriter;
+import java.util.ArrayList;
+import java.util.HashMap;
+import java.util.List;
+import java.util.Map;
+
+import ch.systemsx.cisd.common.exceptions.EnvironmentFailureException;
+import ch.systemsx.cisd.common.fasta.FastaUtilities;
+import ch.systemsx.cisd.common.fasta.SequenceType;
+import ch.systemsx.cisd.common.filesystem.FileUtilities;
+import ch.systemsx.cisd.common.string.Template;
+
+/**
+ * Helper class to create temporary FASTA files.
+ *
+ * @author Franz-Josef Elmer
+ */
+class FastaFileBuilder
+{
+    private static final class FastaEntry
+    {
+        private List<String> lines = new ArrayList<String>();
+        private SequenceType seqType;
+        
+        FastaEntry(String id)
+        {
+            lines.add(">" + id);
+        }
+        
+        void setSeqType(SequenceType seqType)
+        {
+            this.seqType = seqType;
+        }
+        
+        SequenceType getSeqType()
+        {
+            return seqType;
+        }
+        
+        void appendSeq(String seq)
+        {
+            lines.add(seq);
+        }
+        
+        List<String> getLines()
+        {
+            return lines;
+        }
+    }
+    
+    private enum EntryType { FASTA, FASTQ }
+    
+    private static final Template ID_EXTENSION_TEMPLATE = new Template("[Data set: ${data_set}, File: ${file}]");
+    
+    private final String dataSetCode;
+    private final File tempFolder;
+    
+    private final Map<SequenceType, PrintWriter> writers = new HashMap<SequenceType, PrintWriter>();
+    private String idExtension;
+    private FastaEntry currentFastaEntry;
+
+    private EntryType currentEntryType;
+
+    FastaFileBuilder(File tempFolder, String dataSetCode)
+    {
+        this.tempFolder = tempFolder;
+        this.dataSetCode = dataSetCode;
+    }
+    
+    void setFilePath(String filePath)
+    {
+        writeFastaEntry();
+        Template template = ID_EXTENSION_TEMPLATE.createFreshCopy();
+        template.bind("data_set", dataSetCode);
+        template.bind("file", filePath);
+        idExtension = template.createText();
+    }
+    
+    void handle(String line)
+    {
+        EntryType entryType = tryToGetEntryType(line);
+        if (entryType != null)
+        {
+            writeFastaEntry();
+            if (idExtension == null)
+            {
+                throw new IllegalStateException("File path not set [Data Set: " + dataSetCode + "].");
+            }
+            currentFastaEntry = new FastaEntry(line.substring(1) + " " + idExtension);
+            currentEntryType = entryType;
+        } else
+        {
+            if (currentFastaEntry == null)
+            {
+                throw new IllegalStateException("Invalid line " + idExtension + ". Line with identifier expected: " + line);
+            }
+            if (currentFastaEntry.getSeqType() == null)
+            {
+                currentFastaEntry.setSeqType(FastaUtilities.determineSequenceType(line));
+                currentFastaEntry.appendSeq(line);
+            } else if (currentEntryType == EntryType.FASTA)
+            {
+                currentFastaEntry.appendSeq(line);
+            }
+        }
+    }
+    
+    void finish()
+    {
+        writeFastaEntry();
+        for (PrintWriter printWriter : writers.values())
+        {
+            printWriter.close();
+        }
+    }
+    
+    File getTemporaryNuclFastaFileOrNull()
+    {
+        return getTemporaryFastaFileOrNull(SequenceType.NUCL);
+    }
+    
+    File getTemporaryProtFastaFileOrNull()
+    {
+        return getTemporaryFastaFileOrNull(SequenceType.PROT);
+    }
+    
+    File getTemporaryFastaFileOrNull(SequenceType seqType)
+    {
+        return writers.containsKey(seqType) ? getFastaFile(seqType) : null;
+    }
+    
+    void cleanUp()
+    {
+        SequenceType[] values = SequenceType.values();
+        for (SequenceType sequenceType : values)
+        {
+            File file = getTemporaryFastaFileOrNull(sequenceType);
+            if (file != null)
+            {
+                FileUtilities.delete(file);
+            }
+        }
+    }
+    
+    private void writeFastaEntry()
+    {
+        if (currentFastaEntry == null)
+        {
+            return;
+        }
+        SequenceType seqType = currentFastaEntry.getSeqType();
+        List<String> lines = currentFastaEntry.getLines();
+        if (seqType == null)
+        {
+            throw new IllegalStateException("Unknown type of the following FASTA entry: " + lines);
+        }
+        PrintWriter printer = getPrinter(seqType);
+        for (String line : lines)
+        {
+            printer.println(line);
+        }
+        currentFastaEntry = null;
+    }
+    
+    private PrintWriter getPrinter(SequenceType seqType)
+    {
+        PrintWriter printWriter = writers.get(seqType);
+        if (printWriter == null)
+        {
+            File fastaFile = getFastaFile(seqType);
+            try
+            {
+                printWriter = new PrintWriter(new BufferedWriter(new FileWriter(fastaFile)));
+                writers.put(seqType, printWriter);
+            } catch (IOException ex)
+            {
+                throw new EnvironmentFailureException("Couldn't create temporary FASTA file '" + fastaFile 
+                        + "': " + ex.getMessage());
+            }
+        }
+        return printWriter;
+    }
+
+    private File getFastaFile(SequenceType seqType)
+    {
+        return new File(tempFolder, dataSetCode + "-" + seqType.toString().toLowerCase() + ".fa");
+    }
+    
+    private EntryType tryToGetEntryType(String line)
+    {
+        return line.startsWith(">") ? EntryType.FASTA : (line.startsWith("@") ? EntryType.FASTQ : null);
+    }
+    
+}
\ No newline at end of file
diff --git a/datastore_server/sourceTest/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilderTest.java b/datastore_server/sourceTest/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilderTest.java
new file mode 100644
index 00000000000..8804189e4b5
--- /dev/null
+++ b/datastore_server/sourceTest/java/ch/systemsx/cisd/etlserver/plugins/FastaFileBuilderTest.java
@@ -0,0 +1,196 @@
+/*
+ * Copyright 2014 ETH Zuerich, SIS
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package ch.systemsx.cisd.etlserver.plugins;
+
+import java.io.File;
+
+import org.testng.annotations.BeforeMethod;
+import org.testng.annotations.Test;
+
+import ch.systemsx.cisd.base.tests.AbstractFileSystemTestCase;
+import ch.systemsx.cisd.common.filesystem.FileUtilities;
+
+
+
+/**
+ * 
+ *
+ * @author Franz-Josef Elmer
+ */
+public class FastaFileBuilderTest extends AbstractFileSystemTestCase
+{
+    private static final String DATA_SET_CODE = "11358-13";
+    private File tempFolder;
+    private FastaFileBuilder builder;
+
+    @BeforeMethod
+    public void setUpTempFolder()
+    {
+        tempFolder = new File(workingDirectory, "temp");
+        tempFolder.mkdirs();
+        builder = new FastaFileBuilder(tempFolder, DATA_SET_CODE);
+    }
+
+    @Test
+    public void testThreeNuclEntriesFromTwoFastaFiles()
+    {
+        builder.setFilePath("my-data/1.fa");
+        builder.handle(">lcl|1 example 1");
+        builder.handle("GTTTACCCAAACTTCTATATGACTT");
+        builder.handle("AAATTAAAATAATGCTGAGATGATA");
+        builder.handle(">lcl|2 example 2");
+        builder.handle("GACTTCTATATGATTTACCCAACTT");
+        builder.handle("ATAATGCTGAATTAAAATAAGATGA");
+        builder.setFilePath("my-data/2.fa");
+        builder.handle(">lcl|3 example 3");
+        builder.handle("GACTTCTTTATATGATTTACCCAACTTAGCGT");
+        builder.finish();
+        
+        assertEquals(null, builder.getTemporaryProtFastaFileOrNull());
+        File temporaryNuclFastaFile = builder.getTemporaryNuclFastaFileOrNull();
+        assertEquals(DATA_SET_CODE + "-nucl.fa", FileUtilities.getRelativeFilePath(tempFolder, temporaryNuclFastaFile));
+        assertEquals(">lcl|1 example 1 [Data set: 11358-13, File: my-data/1.fa]\n"
+                + "GTTTACCCAAACTTCTATATGACTT\n"
+                + "AAATTAAAATAATGCTGAGATGATA\n"
+                + ">lcl|2 example 2 [Data set: 11358-13, File: my-data/1.fa]\n"
+                + "GACTTCTATATGATTTACCCAACTT\n"
+                + "ATAATGCTGAATTAAAATAAGATGA\n"
+                + ">lcl|3 example 3 [Data set: 11358-13, File: my-data/2.fa]\n"
+                + "GACTTCTTTATATGATTTACCCAACTTAGCGT",
+                FileUtilities.loadToString(temporaryNuclFastaFile).trim());
+    }
+
+    @Test
+    public void testFastqFiles()
+    {
+        builder.setFilePath("my-data/1.fastq");
+        builder.handle("@lcl|1 example 1");
+        builder.handle("GTTTACCCAAACTTCTATATGACTT");
+        builder.handle("+");
+        builder.handle("d^dddadd^BBBBBBefcfffffcc");
+        builder.handle("@lcl|2 example 2");
+        builder.handle("ATAATGCTGAATTAAAATAAGATGA");
+        builder.handle("BBBefcfffffd^dddadd^BBBcc");
+        builder.handle("@lcl|3 example 3");
+        builder.handle("GACTTCTTTATATGATTTACCCAACTTAGCGT");
+        builder.handle("@lcl|4 example 4");
+        builder.handle("GACTTCTTTATATGCTTAGCGTATTTACCCAA");
+        builder.handle("+");
+        builder.finish();
+        
+        assertEquals(null, builder.getTemporaryProtFastaFileOrNull());
+        File temporaryNuclFastaFile = builder.getTemporaryNuclFastaFileOrNull();
+        assertEquals(DATA_SET_CODE + "-nucl.fa", FileUtilities.getRelativeFilePath(tempFolder, temporaryNuclFastaFile));
+        assertEquals(">lcl|1 example 1 [Data set: 11358-13, File: my-data/1.fastq]\n"
+                + "GTTTACCCAAACTTCTATATGACTT\n"
+                + ">lcl|2 example 2 [Data set: 11358-13, File: my-data/1.fastq]\n"
+                + "ATAATGCTGAATTAAAATAAGATGA\n"
+                + ">lcl|3 example 3 [Data set: 11358-13, File: my-data/1.fastq]\n"
+                + "GACTTCTTTATATGATTTACCCAACTTAGCGT\n"
+                + ">lcl|4 example 4 [Data set: 11358-13, File: my-data/1.fastq]\n"
+                + "GACTTCTTTATATGCTTAGCGTATTTACCCAA",
+                FileUtilities.loadToString(temporaryNuclFastaFile).trim());
+    }
+    
+    @Test
+    public void testNuclFastaFileAndProtFastaFile()
+    {
+        builder.setFilePath("my-data/1.fa");
+        builder.handle(">lcl|1 example 1");
+        builder.handle("GTTTACCCAAACTTCTATATGACTT");
+        builder.handle("AAATTAAAATAATGCTGAGATGATA");
+        builder.handle(">lcl|2 example 2");
+        builder.handle("GACTTCTATATGATTTACCCAACTT");
+        builder.handle("ATAATGCTGAATTAAAATAAGATGA");
+        builder.setFilePath("my-data/2.fa");
+        builder.handle(">lcl|3 example 3");
+        builder.handle("VGLTNYAAAYCTGLLLAR");
+        builder.finish();
+        
+        File temporaryNuclFastaFile = builder.getTemporaryNuclFastaFileOrNull();
+        assertEquals(DATA_SET_CODE + "-nucl.fa", FileUtilities.getRelativeFilePath(tempFolder, temporaryNuclFastaFile));
+        assertEquals(">lcl|1 example 1 [Data set: 11358-13, File: my-data/1.fa]\n"
+                + "GTTTACCCAAACTTCTATATGACTT\n"
+                + "AAATTAAAATAATGCTGAGATGATA\n"
+                + ">lcl|2 example 2 [Data set: 11358-13, File: my-data/1.fa]\n"
+                + "GACTTCTATATGATTTACCCAACTT\n"
+                + "ATAATGCTGAATTAAAATAAGATGA",
+                FileUtilities.loadToString(temporaryNuclFastaFile).trim());
+        File temporaryProtFastaFile = builder.getTemporaryProtFastaFileOrNull();
+        assertEquals(DATA_SET_CODE + "-prot.fa", FileUtilities.getRelativeFilePath(tempFolder, temporaryProtFastaFile));
+        assertEquals(">lcl|3 example 3 [Data set: 11358-13, File: my-data/2.fa]\n"
+                + "VGLTNYAAAYCTGLLLAR",
+                FileUtilities.loadToString(temporaryProtFastaFile).trim());
+    }
+    
+    @Test
+    public void testCleanUp()
+    {
+        builder.setFilePath("my-data/1.fa");
+        builder.handle(">lcl|1 example 1");
+        builder.handle("GTTTACCCAAACTTCTATATGACTT");
+        builder.finish();
+        File temporaryNuclFastaFile = builder.getTemporaryNuclFastaFileOrNull();
+        assertEquals(true, temporaryNuclFastaFile.exists());
+        
+        builder.cleanUp();
+        
+        assertEquals(false, temporaryNuclFastaFile.exists());
+    }
+    
+    @Test
+    public void testUnspecifiedFilePath()
+    {
+        try
+        {
+            builder.handle(">lcl|1");
+        } catch (IllegalStateException ex)
+        {
+            assertEquals("File path not set [Data Set: 11358-13].", ex.getMessage());
+        }
+    }
+    
+    @Test
+    public void testMissingIdLine()
+    {
+        builder.setFilePath("my-data/1.fa");
+        try
+        {
+            builder.handle("GATTACA");
+        } catch (IllegalStateException ex)
+        {
+            assertEquals("Invalid line [Data set: 11358-13, File: my-data/1.fa]. "
+                    + "Line with identifier expected: GATTACA", ex.getMessage());
+        }
+    }
+    
+    @Test
+    public void testMissingSequenceLine()
+    {
+        builder.setFilePath("my-data/1.fa");
+        builder.handle(">lcl|1");
+        try
+        {
+            builder.finish();
+        } catch (IllegalStateException ex)
+        {
+            assertEquals("Unknown type of the following FASTA entry: "
+                    + "[>lcl|1 [Data set: 11358-13, File: my-data/1.fa]]", ex.getMessage());
+        }
+    }
+    
+}
-- 
GitLab